Abstract Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder resulting in motor neuron (MN) loss. There are currently no effective therapies; however, cellular therapies using neural progenitor cells protect MNs and attenuate disease progression in G93A-SOD1 ALS rats. Recently, we completed a phase I clinical trial examining intraspinal human spinal stem cell (HSSC) transplantation in ALS patients which demonstrated our approach was safe and feasible, supporting the phase II trial currently in progress.

In parallel, efforts focused on understanding the mechanisms underlying the preclinical benefit of HSSCs in vitro and in animal models of ALS led us to investigate how insulin-like growth factor-I (IGF-I) production contributes to cellular therapy neuroprotection. IGF-I is a potent growth factor with proven efficacy in preclinical ALS studies, and we contend that autocrine IGF-I production may enhance the salutary effects of HSSCs.

Incarcat de Accesari 1109 Data 30.10.10 Marime 5.1 MB Browserul tau nu suporta HTML5.

By comparing the biological properties of HSSCs to HSSCs expressing sixfold higher levels of IGF-I, we demonstrate that IGF-I production augments the production of glial-derived neurotrophic factor and accelerates neurite outgrowth without adversely affecting HSSC proliferation or terminal differentiation. Furthermore, we demonstrate that increased IGF-I induces more potent MN protection from excitotoxicity via both indirect and direct mechanisms, as demonstrated using hanging inserts with primary MNs or by culturing with organotypic spinal cord slices, respectively. These findings support our theory that combining autocrine growth factor production with HSSC transplantation may offer a novel means to achieve additive neuroprotection in ALS. S tem C ells 20–1489 • • Introduction Amyotrophic lateral sclerosis (ALS) is a lethal neurodegenerative disease resulting in upper and lower motor neuron (MN) loss. There are no effective treatments and death typically occurs within 3–5 years of onset []. One obstacle facing therapeutic development is the complex, unclear etiology and several mechanisms have been proposed, including oxidative stress, mitochondrial dysfunction, a toxic microenvironment, astrocytic and glial dysfunction, loss of distal neuromuscular junctions, and a breakdown in local neurocircuitry within the spinal cord [].

In addition, reductions in trophic factors within the spinal cord microenvironment in ALS further enhance MN susceptibility to the disease process []. Given this complexity, it is likely that a multifaceted treatment approaches may be warranted. Cellular therapies are a new therapeutic avenue for ALS; they provide de novo neural tissue to support neurocircuitry and represent a source for in situ production of neuroprotective growth factors []. Recently, we completed a phase I clinical trial examining intraspinal transplantation of human spinal stem cells (HSSCs) in 15 ALS patients, validating the feasibility and safety of this cellular therapy approach []. Phase II of the trial examining dosing and efficacy is ongoing, and in parallel, investigations in the laboratory are focused on understanding the mechanisms underlying how HSSCs support MNs in ALS. Previous work in G93A-SOD1 ALS rats confirmed that HSSCs integrate into the spinal cord, form synapses with host tissue, maintain MN numbers, and produce several neuroprotective growth factors, including glial cell-derived neurotrophic factor (GDNF), brain-derived neurotrophic factor (BDNF), vascular endothelial growth factor (VEGF), and insulin-like growth factor-I (IGF-I) following intraspinal transplantation [].

Of these growth factors, IGF-I is the most highly expressed, suggesting it may contribute to HSSC-mediated neuroprotection. IGF-I has potent neurotrophic and neuroprotective effects and extensive preclinical evidence supports the attenuation of MN loss and maintenance of neuronal synapses and neuromuscular junctions by IGF-I []. We and others have shown that viral-mediated IGF-I delivery increases MN numbers, improves grip strength, delays progression, and prolongs survival in ALS rodents []. A phase III trial investigating subcutaneous IGF-I in ALS patients, however, did not successfully demonstrate therapeutic efficacy, although this was likely due to failure of IGF-I to reach the spinal cord and confer continuous protection to diseased MNs []. The ability of cellular therapies to provide localized neurotrophic support directly to MNs within the spinal cord microenvironment may circumvent the issues encountered in earlier IGF-I trials. In this study, we developed a novel stem cell line expressing increased IGF-I levels, HSSC:IGF-I, to examine the potential contributions of autocrine and paracrine IGF-I production to neuroprotection within the neuromuscular axis. Specifically, we assess the differences between HSSCs expressing lower levels of IGF-I and HSSC:IGF-I, focusing on growth factor production and the potential actions of IGF-I on cell proliferation, migration, and differentiation.

We further explore the additive role of IGF-I in neuroprotection by examining the ability of HSSC:IGF-I to provide MN protection against excitotoxicity compared to HSSCs. We anticipate these studies will demonstrate how autocrine and paracrine growth factor production contributes to cellular therapy neuroprotection and lend further support to our contention that HSSCs confer multifaceted therapeutic benefits in ALS.

Materials and Methods HSSC and HSSC:IGF-I Culture HSSCs (NSI-566RSC) were prepared from spinal cord tissue obtained from a single 8-week human fetus following an elective abortion as described previously []. To generate HSSC:IGF-I, HSSCs were exposed to replication-defective recombinant lentivirus engineered to overexpress a prepro-isoform of human IGF-I cDNA driven by the human ubiquitin C (Ubc) promoter. The resulting cells were propagated as a single cell line without further selection and named NSI-566RSC.Ubc_IGF-I. Using a control construct expressing green fluorescent protein (GFP) under the same promoter, approximately 90%–95% of the proliferating cells were GFP-positive. Cell culture followed established protocols [] using culture reagents obtained from Sigma (St. Louis, MO, ), unless otherwise noted.

Briefly, culture vessels were coated with 100 µg/ml poly( d-lysine) (PDL; Millipore, Billerica, MA, ) in HEPES buffer and incubated for 24 hours at room temperature. Surfaces were then washed three times with sterile water and allowed to completely dry under the hood before coating with 25 µg/ml fibronectin in phosphate buffered saline (PBS) for 1 hour. Fibronectin solution was aspirated and vessels were used immediately without drying. HSSC and HSSC:IGF-I were maintained in Dulbecco's modified Eagle's medium (DMEM)/F-12 (Gibco, Life Technologies, Carlsbad, CA, ) supplemented with 100 mg/l human plasma apo-transferrin, 25 mg/l recombinant human insulin, 1.56 g/l glucose, 20 nM progesterone, 100 µM putrescine, and 30 nM sodium selenite. For maintenance in a progenitor state, 10 ng/ml fibroblast growth factor (FGF) was added to the growth media.

For differentiation, cells were cultured in differentiation media comprised of DMEM without FGF, supplemented with 4 mM l-glutamine, 20 µM l-alanine, 6 µM l-asparagine, 67 µM l-proline, 250 nM vitamin B12, 25 mg/l insulin, 100 mg/l transferrin, 20 nM progesterone, 100 µM putrescine, and 30 nM sodium selenite, for 7 days, with a 50% media change every other day. Cells were analyzed in their undifferentiated state (D0) or after 3 or 7 days (D3 or D7, respectively) of differentiation.

ELISA, Dot Blot Analysis, and Western Blotting To confirm that lentiviral transduction led to increased stable expression of IGF-I, conditioned media were collected after 10 passages and analyzed by ELISA. To collect conditioned media, flasks were washed with PBS, 10 ml growth (D0) or differentiation (D3, D6, and D7) media without insulin was added, and cells were cultured for 24 hours prior to media collection. Conditioned media were concentrated 10-fold to 1 ml using Centricon filters (3 kDa cut off; Millipore) following the manufactures' guidelines and IGF-I levels at D0 and D6 were quantified using a human-specific IGF-I ELISA (R&D Systems, Minneapolis, MN, ). For dot blotting, concentrated media (200 µl) from D0 and D7 cultures were applied to nitrocellulose membranes using a Whatman Schleicher & Schuell Minifold I filtration manifold (Sigma) and membranes were exposed overnight at 4°C to primary antibodies, including GDNF (Abbiotec, San Diego, CA, ), VEGF (Santa Cruz Biotechnology, SantaCruz, CA, ), and BDNF (Santa Cruz Biotechnology), followed by 1 hour incubation at room temperature with appropriate horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology). Antibody binding was developed with LumiGLO Reagent and Peroxide (Cell Signaling, Danvers, MA, ) and exposed to Kodak BioMax XAR film (Sigma). Western blotting on D0, D3, and D7 cell lysates was performed as previously described []. Equal amounts of protein were loaded on either 10% or 12%, polyacrylamide gels, dependent on the size of the protein of interest.

Polyvinylidene difluoride membranes were incubated with primary antibody overnight at 4°C and with appropriate horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology) for 1 hour at room temperature. Primary antibodies were from Cell Signaling unless otherwise indicated and included IGF-I receptor (IGF-IR)-beta (IGF-IRβ, Tyr1135/1136), VEGF receptor (VEGFR), and GAPDH (Millipore). Antibody binding was visualized as described above. Quantitative Real-Time RT-PCR Total RNA was extracted from HSSC and HSSC:IGF-I at D0 and D7 using an RNeasy Kit (Qiagen, Valencia, CA, ) following the manufacturers' instructions. Reverse transcription was performed using the iScript cDNA Synthesis kit (Bio-Rad, Hercules, CA, ).

Quantitative real-time RT-PCR (QPCR) analysis was performed using Power SYBR Green PCR Master Mix and a StepOnePlus thermal cycler (Applied Biosystems, Life Technologies, Grand Island, NY, ) using primers for IGF-IR, VEGF, GDNF, BDNF, vGlut1, vGlut3, GluR2, and GAD67 (Table; []). MRNA expression levels were calculated by the cycle threshold (Ct) value using StepOne v2.2.2 system software and normalized to an endogenous reference gene (GAPDH: ΔCt) and then relative to a control group (ΔΔCt), and were expressed as 2 −ΔΔCt. Averages were calculated from two runs per sample and then averaged for three biological replicates. Table 1. Quantitative real-time RT-PCR primer sequences Forward Reverse • Abbreviations: BDNF, brain-derived neurotrophic factor; GAD67, glutamate decarboxylase; GDNF, glial cell-derived neurotrophic factor; IGF-IR, insulin-like growth factor-I receptor; VEGF, vascular endothelial growth factor; vGlut1, vesicular glutamate transporter 1; vGlut3, vesicular glutamate transporter 3. IGF-IR CAATAAGTTCGTCCACAGAGACC CCTCCTTTCCGGTAATAGTCTGT VEGF ATGGCAGAAGGAGGAGG ATTGGATGGCACTAGCTGCG GDNF CTGACTTGGGTCTGGGCTATG TTGTCACTCACCAGCCTTCTATTT BDNF CCAAGGCAGGTTCAAGAGG TCCAGCAGAAAGAGAAGAGGA vGlut1 AAGTTCCAGGTTTCTGTTCCTTT ACCATGACTACCATTGTGAGGTT vGlut3 GGGGTGTTGGTGCAGTACATT CCCCTCTCCTATGCTTGTCTCTA GAD67 GCCAGACAAGCAGTATGATGT CCAGTTCCAGGCATTTGTTGAT Cell Proliferation and Migration Cell proliferation was measured using a Click-iT EdU Kit (Invitrogen, Life Technologies, Carlsbad, CA, ). Briefly, D0 undifferentiated and D3 differentiated HSSC and HSSC:IGF-I were incubated with 10 µM 5′-ethynyl-2′-deoxyuridine (EdU) for 2 hours and cells were fixed and processed according to the manufacturers' protocols.

EdU incorporation was detected by the presence of fluorescence, and images were captured using an Olympus BX-51 microscope equipped with a digital camera. EdU-positive cell numbers represent quantification of a minimum of 2,000 cells from five images in three independent experiments. Cell migration was assessed using a semipermeable transwell system by seeding cells onto 8 µm pore transwell inserts (BD Biosciences, Bedford, MA, ) at D0 or D7 at a concentration of 1 × 10 6 cells per milliliter. Differentiation media plus 10% fetal bovine serum with or without IGF-I (final concentration of 10 nM) was added to the lower chambers and transwell inserts containing HSSC or HSSC:IGF-I were placed over the chambers. After 24 hours, cells that had migrated through the insert were stained using the QCM 24-Well Colorimetric Cell Migration Assay (Millipore) and quantified by colorimetric measurement using LabSystems Fluoroskan Ascent FL (Thermo Fisher Scientific, Waltham, MA, ) at optical densities of 530 and 590 nm. Immunocytochemistry and Neural Index Assays Immunocytochemistry was performed as previously described [].

HSSC/HSSC:IGF-I were grown on PDL and fibronectin-coated glass coverslips in 24-well plates for 0, 3, or 7 days, fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton/PBS, and then blocked in 5% normal donkey serum/0.1% Triton/PBS. Primary antibodies for TUJ1 (Neuromics, Edina, MN, ), GAD65/67 (Millipore), VGLUT2 (Millipore), or IGF-IRβ (Sigma) were incubated overnight at 4°C. Following incubation with Cy3, Cy5, or FITC-conjugated secondary antibodies (Jackson ImmunoResearch, Westgrove, PA, ), coverslips were mounted on glass slides using ProLong Gold with DAPI (Molecular Probes, Life Technologies, Carlsbad, CA, ).

Images were collected using an Olympus BX-51 microscope. To measure the extent of neural differentiation, TUJ1 and DAPI-labeled images were analyzed following our published neural index protocol [].

Briefly, TUJ1-labeled and corresponding DAPI images were opened in MetaMorph (Molecular Devices, Sunnyvale, CA, ). Cell number was counted on DAPI images using the “count nuclei” plug-in, with manual adjustments to correct for any miscounted cells. Thresholds on TUJ1 images were then adjusted and the area of neurite coverage was measured using region statistics. The neural index was expressed as neurite area/cell (µm 2/cell). Download Driver Pack 2013 Full Version Free here.

Primary MN Coculture for Excitotoxicity Assays Primary embryonic rat MNs were isolated according to our previously published protocol [] and cultured on PDL-coated glass coverslips in a 24-well plate. After 24 hours, the MNs were fed with 250 µl differentiation media for coculturing with HSSC or HSSC:IGF-I, which were seeded onto PDL-coated 3 µm pore transwell inserts (Corning, Tewksbury, MA, ) and differentiated for 4 days prior to coculturing.

Cocultures were left for 3 days prior to beginning the excitotoxicity assay. All culture reagents were purchased from Gibco, Life Technologies unless otherwise indicated. Excitotoxic stress was induced by adding 100 µM glutamate to the coculture media for 24 hours. The contribution of paracrine IGF-I production to protection was assessed by adding the IGF-IR inhibitor, NVPAEW541 (1 µM), 2 hours prior to glutamate.

After glutamate treatment, MNs were fixed in 4% paraformaldehyde for 10 minutes and TUNEL was used to detect DNA fragmentation []. Samples were labeled with digoxigenin-dUTP and stained with horseradish peroxidase-conjugated antidigoxigenin antibody using the ApopTagPlus In Situ Apoptosis Peroxidase Detection Kit (Chemicon). Alternatively, fluorescent TUNEL processing was carried out as described above with a Fluorescein-labeled conjugate using the ApopTagPlus In Situ Apoptosis Fluorescein Detection Kit (Chemicon). Fluorescent signal was detected and recorded using an Olympus BX-51 microscope. TUNEL-positive cells were counted in at least 10 representative fields per condition by a blinded investigator, per our published protocol, for an average total of approximately 1,000–2,000 MNs per condition []. Organotypic Spinal Cord Slice Cultures for Excitotoxicity Assays Organotypic spinal cord slice cultures were prepared from P5–8 rat pups [].

Briefly, lumbar spinal cords were isolated, membranes were removed, and spinal cord tissue was mounted in 7% agarose for Vibrotome sectioning. Sections (300 µm) were collected in ice cold PBS and three spinal cord slices were added to each Millicell Cell Culture Insert (0.4 µm pore, 300 mm diameter; Millipore) in a six-well plate. Wells were flooded with slice growth media containing 50% minimal essential medium, 25 mM HEPES, 25% heat-inactivated horse serum, and 25% Hanks' balanced saline solution, supplemented with 25.6 mg/ml d-glucose and 2 mM glutamine, at a final pH of 7.2. Cultures were incubated at 37°C in 5% CO 2 for 2 weeks, with media changes every 2 days.

For coculture experiments, 2 µl of HSSC or HSSC:IGF-I cell suspension (6 × 10 3 cells per milliliter) was placed over the ventral horn of the slices 2 days after plating. To induce excitotoxic stress, culture media were supplemented at day 7 with 100 µM threo-hydroxyaspartate (THA; Sigma) to inhibit glutamate transport until day 14. Slices were fixed in 4% PFA and processed for standard immunocytochemistry as described above, using SMI-32/ChAT (Millipore) to label large alpha MNs and HuNu (Millipore) to confirm HSSC and HSSC:IGF-I placement on the spinal slices. Fluorescent images were captured using an Olympus BX-51 microscope and SMI-32/ChAT-labeled MNs were quantified in the ventral horns of each slice. The total remaining MNs were quantified from nine slices per condition from three independent experiments. Statistical Analyses All results are representative of at least three independent experiments. Statistical significance was determined using one-way ANOVA followed by Tukey's multiple comparison test or linear regression analysis (GraphPad Prism, La Jolla, CA, ).

Results Characterization of Growth Factor Production by HSSC:IGF-I To examine the contribution of IGF-I production to HSSC neuroprotection, a lentivirus encoding full length human IGF-I was used to generate HSSC:IGF-I. ELISA on conditioned media from HSSC and HSSC:IGF-I cultures demonstrated that HSSCs produce low basal levels of 0.2 fg/cell per day IGF-I, a level that was consistent throughout the first week of differentiation (Fig. HSSC:IGF-I exhibited a sixfold increase in IGF-I production, averaging approximately 1.2 fg/cell per day (Fig.

A), and this increased IGF-I production was maintained as the cells underwent differentiation. We next assessed the levels of several growth factors typically expressed by HSSCs using dot blot analysis on conditioned media from undifferentiated cells (D0) and cells after 7 days (D7) of differentiation. VEGF secretion was comparable in HSSC and HSSC:IGF-I and decreased similarly as both cell lines differentiated, while BDNF levels were consistent between cell lines and time points (Fig. GDNF levels were also comparable at D0; however, at D7, higher levels of GDNF were detected in conditioned media from HSSC:IGF-I compared to that from HSSCs (Fig. As previous studies have shown that HSSCs respond to IGF-I signaling, we also explored how growth factor receptor levels are regulated by paracrine IGF-I expression. IGF-IR protein levels in both cell lines throughout differentiation were reduced in HSSC:IGF-I relative to HSSCs at each time point examined (Fig. Given the association between IGF-I expression and VEGF signaling, we also investigated the effect of increased IGF-I expression on VEGFR levels.

VEGFR is only expressed by HSSC and HSSC:IGF-I at D0; however, basal levels of VEGFR were considerably lower in HSSC:IGF-I compared to HSSC (Fig. Finally, to validate our protein expression results, we performed QPCR and similarly observed no measurable difference in the expression levels of IGF-IR (Fig. D), VEGF (Fig. E), or BDNF (Fig.

G) between cell lines at the time points examined, although we did detect a significant increase in D7 HSSC:IGF-I GDNF transcript levels relative to levels in D7 HSSCs (Fig. F), a finding consistent with our protein expression analyses. Together, these results demonstrate significantly increased IGF-I production by HSSC:IGF-I that is maintained through 7 days of differentiation and is also accompanied by reduced early VEGFR expression and increased D7 GDNF expression. • • HSSC and HSSC:IGF-I growth factor and receptor profiles.

(A): ELISA on HSSCs and HSSC:IGF-I conditioned media demonstrates the levels of IGF-I production in undifferentiated (D0) cells and in cells on D6 of differentiation. (B): Dot blot comparison of VEGF, GDNF, and BDNF levels in conditioned media from HSSCs and HSSC:IGF-I at D0 and D7. (C): Western blot analysis of growth factor receptor levels for IGF-IR and VEGFR in HSSC and HSSC:IGF-I lysates at D0, D3, and D7. (D–F): Quantitative real-time RT-PCR (QPCR) analysis of IGF-IR (D), VEGF (E), GDNF (F), and BDNF (G) expression at D0 and D7 in HSSCs and HSSC:IGF-I. QPCR data were normalized to GAPDH and presented as a fold-change from D0 HSSCs.

Data are presented as mean + SD (*, p. • • HSSC and HSSC:IGF-I proliferation and migration. (A–E): Representative images of the percentage of EdU-positive HSSCs and HSSC:IGF-I at D0 (B and C, respectively) and D3 (D and E, respectively) for measuring proliferation (A). (F): Relative migration levels of undifferentiated D0 HSSCs and HSSC:IGF-I, expressed as OD. Data are presented as mean + SD (*, p.

• • HSSC and HSSC:IGF-I differentiation. (A–C): Representative images of TUJ1 and DAPI-labeled HSSC (B) and HSSC:IGF-I (C) for calculation of the neural index (A) at D7. (D–G): Quantitative real-time RT-PCR (QPCR) analysis of phenotypic markers of differentiated neurons including vGlut1 (D), vGlut3 (E), GluR2 (F), and GAD (G).

QPCR data were normalized to GAPDH and presented as a fold-change from D0 HSSC. Data are shown as mean + SD (*, p. • • Neuroprotective potential of HSSCs and HSSC:IGF-I.

(A): Quantification of MN death using the TUNEL assay following exposure to glutamate (100 µM) in the absence or presence of HSSCs or HSSC:IGF-I cocultured using transwell inserts. IGF-IR inhibition by NVPAEW541 (1 µM) was used to determine the contribution of paracrine IGF-I production to neuroprotection. Data are presented as mean + SD (*, p. • 1 Zinman L, Cudkowicz M.

Emerging targets and treatments in amyotrophic lateral sclerosis. Lancet Neurol 2011; 10: 481– 490.

• • • • • 2 Ilieva H, Polymenidou M, Cleveland DW. Non-cell autonomous toxicity in neurodegenerative disorders: ALS and beyond. J Cell Biol 2009; 187: 761– 772. • • • • • 3 Just N, Moreau C, Lassalle P et al. High erythropoietin and low vascular endothelial growth factor levels in cerebrospinal fluid from hypoxemic ALS patients suggest an abnormal response to hypoxia. Neuromuscul Disord 2007; 17: 169– 173. • • • • • 4 Bilic E, Bilic E, Rudan I et al.

Comparison of the growth hormone, IGF-1 and insulin in cerebrospinal fluid and serum between patients with motor neuron disease and healthy controls. Eur J Neurol 2006; 13: 1340– 1345.

• • • • 5 Devos D, Moreau C, Lassalle P et al. Low levels of the vascular endothelial growth factor in CSF from early ALS patients. 2004; 62: 2127– 2129. • • • • • 6 Lunn JS, Sakowski SA, Hur J et al.

Stem cell technology for neurodegenerative diseases. Ann Neurol 2011; 70: 353– 361. • • • • • 7 Lunn JS, Sakowski SA, Federici T et al. Stem cell technology for the study and treatment of motor neuron diseases. Regen Med 2011; 6: 201– 213. • • • • 8 Boulis NM, Federici T, Glass JD et al.

Translational stem cell therapy for amyotrophic lateral sclerosis. Nat Rev Neurol 2011; 8: 172– 176. • • • • • 9 Glass JD, Boulis NM, Johe K et al. Lumbar intraspinal injection of neural stem cells in patients with amyotrophic lateral sclerosis: Results of a phase I trial in 12 patients.

Stem Cells 2012; 30: 1144– 1151. • • • • • 10 Riley J, Federici T, Polak M et al. Intraspinal stem cell transplantation in amyotrophic lateral sclerosis: A phase I safety trial, technical note, and lumbar safety outcomes. Neurosurgery 2012; 71: 405– 416. • • • • 11 Feldman EL, Boulis NM, Hur J et al.

Intraspinal neural stem cell transplantation in amyotrophic lateral sclerosis: Phase 1 trial outcomes. Ann Neurol 2014; 75: 363– 373. • • • • 12 Lunn JS, Sakowski SA, Feldman EL. Stem cell therapies for amyotrophic lateral sclerosis: Recent advances and prospects for the future. Stem Cells 2014; 32: 1099– 1109. • • • • • 13 Riley J, Glass J, Feldman EL et al. Intraspinal stem cell transplantation in amyotrophic lateral sclerosis: A phase I trial, cervical microinjection, and final surgical safety outcomes.

Neurosurgery 2014; 74: 77– 87. • • • • 14 Hefferan MP, Galik J, Kakinohana O et al. Human neural stem cell replacement therapy for amyotrophic lateral sclerosis by spinal transplantation. PLoS One 2012; 7: e42614. • • • • • 15 Xu L, Ryugo DK, Pongstaporn T et al.

Human neural stem cell grafts in the spinal cord of SOD1 transgenic rats: Differentiation and structural integration into the segmental motor circuitry. J Comp Neurol 2009; 514: 297– 309. • • • • • 16 Xu L, Shen P, Hazel T et al. Dual transplantation of human neural stem cells into cervical and lumbar cord ameliorates motor neuron disease in SOD1 transgenic rats. Neurosci Lett 2011; 494: 222– 226. • • • • • 17 Xu L, Yan J, Chen D et al. Human neural stem cell grafts ameliorate motor neuron disease in SOD-1 transgenic rats.

Transplantation 2006; 82: 865– 875. • • • • 18 Yan J, Xu L, Welsh AM et al. Extensive neuronal differentiation of human neural stem cell grafts in adult rat spinal cord. PLoS Med 2007; 4: e39.

• • • • 19 Sakowski SA, Schuyler AD, Feldman EL. Insulin-like growth factor-I for the treatment of amyotrophic lateral sclerosis. Amyotroph Lateral Scler 2009; 10: 63– 73. • • • • • 20 Franz CK, Federici T, Yang J et al. Intraspinal cord delivery of IGF-I mediated by adeno-associated virus 2 is neuroprotective in a rat model of familial ALS. Neurobiol Dis 2009; 33: 473– 481. • • • • • 21 Dodge JC, Haidet AM, Yang W et al.

Delivery of AAV-IGF-1 to the CNS extends survival in ALS mice through modification of aberrant glial cell activity. Mol Ther 2008; 16: 1056– 1064. • • • • • 22 Dodge JC, Treleaven CM, Fidler JA et al. AAV4-mediated expression of IGF-1 and VEGF within cellular components of the ventricular system improves survival outcome in familial ALS mice. Mol Ther 2010; 18: 2075– 2084.

• • • • • 23 Kaspar BK, Llado J, Sherkat N et al. Retrograde viral delivery of IGF-1 prolongs survival in a mouse ALS model. Science 2003; 301: 839– 842. • • • • • • 24 Sorenson EJ, Windbank AJ, Mandrekar JN et al. Subcutaneous IGF-1 is not beneficial in 2-year ALS trial.

Neurology 2008; 71: 1770– 1775. • • • • • 25 Johe KK, Hazel TG, Muller T et al. Single factors direct the differentiation of stem cells from the fetal and adult central nervous system.

Genes Dev 1996; 10: 3129– 3140. • • • • • 26 Cizkova D, Kakinohana O, Kucharova K et al. Functional recovery in rats with ischemic paraplegia after spinal grafting of human spinal stem cells. Neuroscience 2007; 147: 546– 560. • • • • • 27 Lunn JS, Pacut C, Backus C et al.

The pleotrophic effects of insulin-like growth factor-I on human spinal cord neural progenitor cells. Stem Cells Dev 2010; 19: 1983– 1993. • • • • • 28 Vincent AM, Feldman EL, Song DK et al. Adeno-associated viral-mediated insulin-like growth factor delivery protects motor neurons in vitro. Neuromol Med 2004; 6: 79– 86. • • • • 29 Kim B, Leventhal PS, Saltiel AR et al. Insulin-like growth factor-I-mediated neurite outgrowth in vitro requires MAP kinase activation.

J Biol Chem 1997; 272: 21268– 21273. • • • • • 30 Vincent AM, Mobley BC, Hiller A et al.

IGF-I prevents glutamate-induced motor neuron programmed cell death. Neurobiol Dis 2004; 16: 407– 416.

• • • • • 31 Maragakis NJ, Rao MS, Llado J et al. Glial restricted precursors protect against chronic glutamate neurotoxicity of motor neurons in vitro. Glia 2005; 50: 145– 159. • • • • 32 Supeno NE, Pati S, Hadi RA et al. IGF-1 acts as controlling switch for long-term proliferation and maintenance of EGF/FGF-responsive striatal neural stem cells. Int J Med Sci 2013; 10: 522– 531. • • • • • 33 Maucksch C, McGregor AL, Yang M et al.

IGF-I redirects doublecortin-positive cell migration in the normal adult rat brain. Neuroscience 2013; 241: 106– 115. • • • • • 34 Borasio GD, Robberecht W, Leigh PN et al. A placebo-controlled trial of insulin-like growth factor-I in amyotrophic lateral sclerosis.

European ALS/IGF-I Study Group. Neurology 1998; 51: 583– 586.

• • • 35 Lai EC, Felice KJ, Festoff BW et al. Effect of recombinant human insulin-like growth factor-I on progression of ALS. A placebo-controlled study. The North America ALS/IGF-I Study Group. Neurology 1997; 49: 1621– 1630. • • • • • 36 Mitchell JD, Wokke JH, Borasio GD. Recombinant human insulin-like growth factor I (rhIGF-I) for amyotrophic lateral sclerosis/motor neuron disease.

Cochrane Database SystRev 2002: CD002064. • • 37 Kouroupi G, Lavdas AA, Gaitanou M et al. Lentivirus-mediated expression of insulin-like growth factor-I promotes neural stem/precursor cell proliferation and enhances their potential to generate neurons. J Neurochem 2010; 115: 460– 474. • • • • • 38 Floyd S, Favre C, Lasorsa FM et al. The insulin-like growth factor-I-mTOR signaling pathway induces the mitochondrial pyrimidine nucleotide carrier to promote cell growth.

Mol Biol Cell 2007; 18: 3545– 3555. • • • • • 39 Kalluri HS, Vemuganti R, Dempsey RJ. Mechanism of insulin-like growth factor I-mediated proliferation of adult neural progenitor cells: Role of Akt.

Eur J Neurosci 2007; 25: 1041– 1048. • • • • 40 LeRoith D, Roberts CT, Jr. The insulin-like growth factor system and cancer.

Cancer Lett 2003; 195: 127– 137. • • • • • 41 O'Donnell SL, Frederick TJ, Krady JK et al. IGF-I and microglia/macrophage proliferation in the ischemic mouse brain. Glia 2002; 39: 85– 97. • • • • 42 Raore B, Federici T, Taub J et al.

Cervical multilevel intraspinal stem cell therapy: Assessment of surgical risks in Gottingen minipigs. Spine 2011; 36: E164– 171. • • • • 43 Hefferan M, Johe K, Hazel T et al.

Optimization of immunosuppressive therapy for spinal grafting of human spinal stem cells in a rat model of ALS. Cell Transplant 2011; 20: 1153– 1161. • • • • 44 Usvald D, Vodicka P, Hlucilova J et al.

Analysis of dosing regimen and reproducibility of intraspinal grafting of human spinal stem cells in immunosuppressed minipigs. Cell Transplant 2010; 19: 1103– 1122. • • • • 45 Rizvanov AA, Guseva DS, Salafutdinov II et al. Genetically modified human umbilical cord blood cells expressing vascular endothelial growth factor and fibroblast growth factor 2 differentiate into glial cells after transplantation into amyotrophic lateral sclerosis transgenic mice.

Exp Biol Med (Maywood) 2011; 236: 91– 98. • • • • • 46 Hossaini M, Sarac C, Jongen JL et al. Spinal glycinergic and GABAergic neurons expressing C-fos after capsaicin stimulation are increased in rats with contralateral neuropathic pain. Neuroscience 2011; 196: 265– 275. • • • • • 47 Knippenberg S, Thau N, Dengler R et al. Intracerebroventricular injection of encapsulated human mesenchymal cells producing glucagon-like peptide 1 prolongs survival in a mouse model of ALS. PLoS One 2012; 7: e36857.

• • • • • 48 Krakora D, Mulcrone P, Meyer M et al. Synergistic effects of GDNF and VEGF on lifespan and disease progression in a familial ALS rat model. Mol Ther 2013; 21: 1602– 1610. • • • • • 49 Suzuki M, McHugh J, Tork C et al.

Direct muscle delivery of GDNF with human mesenchymal stem cells improves motor neuron survival and function in a rat model of familial ALS. Mol Ther 2008; 16: 2002– 2010. • • • • • 50 Suzuki M, McHugh J, Tork C et al.

GDNF secreting human neural progenitor cells protect dying motor neurons, but not their projection to muscle, in a rat model of familial ALS. PLoS One 2007; 2: e689. • • • • Related content.

By Jonathan Berr Fiscal Times December 27, 2013 Wall Street is a sucker for a good comeback story, and it got plenty of them in 2013. Best Buy shares, for example, have zoomed nearly 250 percent higher this year. Hewlett-Packard, the worst performer in the Dow Jones industrial average in 2012, has nearly doubled this year. Companies like E-Trade Financial, GameStop, Rite Aid and Yahoo have all seen their share prices soar 100 percent or more--sometimes much more--as investors bought into their turnaround tales. Sometimes, though, down-and-out businesses stay that way, or manage to fall even further.

The five companies below have struggled for years to turn around their operations and, for whatever reason, have failed to get themselves back on the right track. We're not predicting that they will go out of business tomorrow, or anytime soon. They.of future years. Martha Stewart Living Omnimedia Martha Stewart's media empire has been circling the drain for years as the diva of domesticity's popularity fades.

Stewart has proven far more adept at fashioning crafts than at developing a coherent, successful corporate strategy. The company's executive offices have seen a revolving cast of managers, but none have managed to get profits blooming.

Revenues in Martha Stewart Living's publishing business have fallen year-over-year for seven straight quarters. During the company's third quarter, its only profitable business was merchandising. Even those profits may be in jeopardy as the company has had to revise its partnership with J.C. Penney after being caught in the middle of a nasty battle between that retailer and Macy's. Investors have complained that Stewart is vastly overpaid and she cut her pay in response. Stewart's best hope is to sell the company but given the trouble she has caused it's hard to imagine who would buy MSO.

Zynga Zynga, the creator of FarmVille and Words With Friends, has suffered a serious drought of follow-up hits. As one analyst recently noted to Bloomberg, with the exception of Zynga Poker, the company has failed to produce a sustained mobile hit in ages. For players of Words With Friends, that would be like having only O's and U's. New CEO Don Mattrick, the former head of Microsoft's Xbox business, was brought on in July to put some zing back in the game-maker. The company has also slashed jobs and cut back on outside contractors in an effort to reduce costs.

Those cuts helped the company post better-than-expected third-quarter results, but unless Mattrick can position Zynga for success in mobile, he's going to have problems gaining traction. He could also play 'find the white knight,' but that's a dangerous game, too. Sears Holdings When billionaire Edward Lampert engineered the merger of Sears and Kmart in 2004, one analyst described it as a 'dream deal.' The reality has been more of a nightmare for long-term shareholders. The ongoing struggles at troubled J.C.

Penney may have overshadowed those at Sears, but sales have fallen at the Hoffman Estates, Ill., company for 27 straight quarters. During the first three quarters of 2013, the once-venerable retailer lost $1 billion. Wall Street analysts expect the red ink to continue for the foreseeable future. Lampert, who became Sears CEO this year, is trying to unload any assets not nailed to the floor as the company's cash begins to dwindle.

Sears has announced plans to spin off Lands' End and sell its auto centers, a deal that one analyst estimates could be worth as much as $2.5 billion. But the company has about $2.8 billion in long-term debt. Sears' struggles are taking a bite out of Lampert's fortune. He was forced to reduce his stake in Sears to under 50 percent because of redemptions from hedge fund clients. As he continues to lose control over Sears, pressure will mount on Lampert to either take the venerable retailer private or sell it to someone else.

Radio Shack Ever since he became CEO earlier this year, Joe Magnacca has vowed to 'transform' the business. That's a tall order. Radio Shack has been struggling to keep pace with technology and stave off fiscal oblivion for years. In 1999, the shares sold for $78.50.

Now, they sell for $2.66. The company has seen its market capitalization shrink by 98 percent. It now has a value of $270.4 million, which is tiny for a national retail chain. Magnacca has tried to breathe new life into the stodgy brand through stunts such as opening a pop-up store in New York's Penn Station. Though Wall Street analysts have welcomed these efforts, many think it's too little, too late.

Radio Shack is in such poor shape that it's unlikely that a buyer would rescue it, at least before it shutters poorly performing stores. Though the company had $613 million in cash as of Sept. 30, its long-term prospects aren't going to improve anytime soon.

MySpace Yes, MySpace, once the dominant social network, still exists. It was acquired in 2011 by a group of investors including Panasonic and singer/actor Justin Timberlake. The investors acquired the site from Rupert Murdoch's News Corp., now 21st Century Fox, for $35 million. Had famously bought the company six years earlier, for $580 million. Under its new management, MySpace has tried to reinvent itself as a social music service.

It relaunched the website earlier this year and undertook a $20 million advertising campaign. Though it has attracted some 36 million users, profits haven't followed and the company announced in November that it had laid off 5 percent of its staff. According to Business Insider, MySpace lost $43 million in 2012. Even worse, a group of small, independent record labels called Merlin has accused MySpace of using its members' content without permission--a situation that will have to be addressed. Even if it does reach a deal with Merlin, MySpace still must find a way to compete against a slew of larger, more popular music services such as those from Apple and Spotify. For MySpace, the music may stop before that happens.

By Dan Moskowitz The Motley Fool December 29, 2013 Over the past three years, the stock market has consistently hit new highs. In this environment, stocks belonging to both good and bad underlying businesses tend to appreciate. However, if you look hard enough, you will find stocks that have grossly underperformed the market. This is often a telling sign that investors don't see current strength or long-term potential for those businesses. Sears Holdings (NASDAQ: SHLD), which is facing much competition from every angle, is an example of this. In fact this short list of competitors: Amazon.com (NASDAQ: AMZN), Wal-Mart Stores (NYSE: WMT), Home Depot (NYSE: HD) and kohl's (NYSE: KSS) is enough to raise concerns.

This has led to stock deprecation of 28% over a three-year time frame. Sears hasn't made any significant changes to its stores, but it has made several significant moves to improve its business. Will these moves be enough to offer investors a dash of hope, or would that hope be merely a mirage? Competition from all angles Sears, the once-dominant department store, failed to change with the times while other companies began offering something unique. For instance, Amazon.com offers the ultimate in convenience with its online retail store.

More people are shopping online every day, and even if Sears and its other department store peers increase their online traffic, they're still going to be well behind Amazon.com. According to website analytics company Alexa.com, Amazon has a global traffic ranking of 10 (with 1 being the highest) and a domestic traffic ranking of 5. On top of that, Amazon's page views per visitor have increased 54.80% to 10.76 over the past three months. Its time-on-site has shot up 63% to 9:03 over the same time frame. These are astronomical numbers, and they're very important to Sears.

Amazon consistently steals customers from all retailers, and Sears is no exception. What makes Sears different is that it can least afford to lose those customers. Consider that other than Amazon, some of Sears' largest competitors include Wal-Mart, Home Depot, and Kohl's. Now take a look at the top-line comparison for these five companies.

Only Sears has suffered a concerning revenue decline. Wal-Mart's revenue increase over the past year isn't overly impressive, but it's not expected to be. Wal-Mart is a large and mature company that finds ways to grow methodically while returning capital to shareholders in the form of dividends and buybacks.

For instance, it currently yields 2.4%. Therefore, its rewards go beyond stock appreciation. Mist important for this comparison, consumers looking for bargain-basement prices will opt for Wal-Mart over Sears. Kohl's revenue has slipped a bit over the past year, primarily due to the suffering middle class, which it tends to target. However, it's still outperforming Sears on the top line, relatively speaking. Home Depot has been stealing business from Sears for years. Home Depot presents a do-it-yourself image, which leads to consumer savings.

This drives consumers into the store. Therefore, while Sears remains No. 1 in annual installation calls (14 million per year), consumers are attempting to do as much as they can on their own these days. This image also leads to foot traffic and increased product sales for Home Depot.

The rebounding housing market doesn't hurt, either. Furthermore, Home Depot yields a 2% dividend. Sears is attempting to offset the increased competition with divestitures and initiatives, but will it be enough?

Divesting and investing Over the past two years, Sears has spun off Sears Hometown and Outlet Stores, Orchard Supply Hardware Stores, and now Lands' End. It acquired the latter for $1.9 billion in 2002. Bringing the brand in-store proved to be a strategic error.

It's possible that Sears will continue its divestment rampage with Kenmore and Craftsman, but that remains to be seen. One thing is certain: Sears is beginning to look much different than it has in the past. In regard to initiatives, the best one Sears has is its Shop Your Way rewards program, which is a free program that offers rewards, personalized deals, and member coupons. There is no minimum required to redeem points. Sears recently announced a Shop Your Way Holiday Bonus, where consumers can earn up to 10% back in points through the reward program through Jan. Additionally, Shop Your Way Max members have an opportunity to receive free two-day shipping on all orders.

This also goes for anyone spending $59 or more. Shop Your Way members can also use the Shop'In app if they're near a Sears or Kmart if they want to place an order and then swing by and pick up their products with ease.

The Shop Your Way program might have potential as a positive catalyst, but will it be enough? Recent divestments will likely help the bottom line, but they're not going to help the top line.

It looks like the goals for Sears are to become smaller and profitable. Though not impossible, these will be difficult tasks, especially considering the company's fiscal situation. Sears generated negative operating cash flow of $694 million over the past year and it's leveraged -- $599 million in cash and short-term equivalents versus $4.70 billion in long-term debt.

The bottom line Americans love a comeback story, and it would be great to see Sears prove almost everyone wrong. However, due to stiff competition, being years behind industry trends, and fiscal weakness, this doesn't seem to be a likely scenario. By Robert Byrnes, The Motley Fool Daily Finance December 26, 2013 Sears Holdings has been struggling to survive.

With 23 quarters of negative earnings Sears has had to sell valuable assets such as Sears Hometown and Outlet Stores, hold a partial spin-off of Sears Canada, and now Lands' End is scheduled to be spun off. Even more shocking is that Sears is losing ground in its hardline business, which includes Craftsman, Kenmore, and Sears Auto, with approximately $2.4 billion less in sales in the first 3 quarters than during the comparable period in 2012. CEO Eddie Lampert is running out of cards, but I think there is one card that just might bring Sears back to life despite intensifying competition from Amazon.com and Wal-Mart Stores. A consumer revolution A revolution occurred throughout the United States right before the turn of the 20th century that changed American consumerism forever, that revolution was the mail-order catalog.

Imagine living in a small town in the Midwest where the only store that sold goods was the general store, where prices generally were high and the selection was low. One day, a catalog arrived that offered almost every good imaginable, truly a 'Book of Wonders', and that book was the Sears catalog. From this catalog you could select any item you wanted, send for it, pay with credit, and the product would arrive in about six weeks with 'Satisfaction Guaranteed'. Amazing, right? Well, compared to today's standards maybe not so much, but back then, Sears opened up the door to mass consumerism. 3 in online retail?

Online retail companies like Amazon are not so different from the Sears Mail Order Catalog; they are truly the modern-day equivalent. A successful online retail company needs superior logistics, warehouse infrastructure across the country, and a means to effectively distribute products to the people. The two largest online retailers are Amazon and Wal-Mart and both have renowned distribution systems; so does number three, Sears. Yes, I know Sears is not who you were expecting to be the third-largest online retailer in the United States, but the company has claimed this spot and it is fighting to not only stay alive, but undergo a complete revitalization. Sears: Back to the roots CEO Eddie Lampert has made a conscious decision to not focus on reinvesting in Sears Department stores like J.C.

Penney has done. Instead, he has changed Sears' focus to online retail with the member-centric Shop Your Way program.

It is paying off, as 70% of all Sears' sales used Shop Your Way so far this year. Sears actually has approximately 100 million products available online at a number of websites under the Sears and Kmart banners. In addition, the company offers multiple transaction choices such as same-day shipping or pick up from one of the nearest Sears stores. That's what I call instant gratification. You won't be picking any items up from an Amazon Store anytime soon! The Shop Your Way initiative has continued to gain traction as members are able to earn points, receive additional benefits, and buy key proprietary brands such as Kenmore, Craftsman, and DieHard. I believe Sears is going to continue to sell assets such as valuable mall-anchor stores and under-performing lines, all while using these sales to continue to grow online and become a marketplace to rival Amazon.

The Will of Fire Richard Sears left the firm when his board decided to focus on department stores instead of the mail-order catalog. Now, ninety years later Sears is shifting away from department stores and toward the Sears Online Market Place. This firm, who fueled the American consumer revolution, is not ready to simply keel over and die; it is adapting, evolving, and fighting for its rich heritage to survive another generation. Sears has a lot of work to do, this is undeniable; competition is fierce across the board and it is no longer the ultimate one-stop shop. In spite of this, the company is making smart decisions by spinning off Lands' End and potentially Sears Auto.

Praise the company for making the difficult-but-smart choice; invest in Sears' revival, and you may be rewarded. 2 retailers you'll want to learn about To learn about two retailers with especially good prospects, take a look at The Motley Fool's special free report: 'The Death of Wal-Mart: The Real Cash Kings Changing the Face of Retail.'

In it, you'll see how these two cash kings are able to consistently outperform and how they're planning to ride the waves of retail's changing tide. You can access it by clicking here. The article Does Sears Have the Will to Survive? Originally appeared on Fool.com. By Francine Kopun Canadian Press December 17, 2013 Ten months after taking over, the company licensed by Sears to provide home installed products and service is in receivership. The company operating as Sears Home Services has gone into receivership, leaving 643 people jobless and putting into limbo $3-million in customer deposits for home installed goods and services ranging from carpeting to roofing.

SHS Services Management Inc. Has been providing home installed products and services under the Sears Home Services banner since February. It went into receivership on Friday, citing liabilities of $17-million. In nine months, SHS lost approximately $14 million and is projected to lose approximately $18.1-million in the year ending Jan. Payroll to Dec.

13 was met, according to court documents. About half of the affected employees - 326 – work in Ontario and include sales associates, installation specialists, inspectors, managers and office assistants, among others.

They work in SHS warehouses, Sears warehouses and Sears stores. Customers who have made deposits with Sears Home Services for home installed products are being asked to call 1-855-376-8474 and leave a message to learn what will become of their money. Sears Canada spokesman Vince Power said in an email that the company is working with PwC Canada, which is handling the receivership, to ensure that customers are looked after and that all Sears Home Services warranties are honoured. 'Looking after customers is our priority,' he added.

In an affidavit filed with the court, Micheal Clements, the remaining director of SHS at the time, said the firm agreed to purchase the home installation business from Sears largely because of the $208 million in annual and likely sales projections initially represented by Sears to SHS. But the anticipated volume of revenue never approached the amounts represented and by late September SHS was experiencing significant liquidity issues, according to the affidavit by Clements. It wasn't supposed to turn out this way. In January, Sears Canada Inc. Issued a press release saying it was entering into what it called a strategic alliance with SHS Services Management Inc.

To operate the home improvement business. 'Combining Sears brand, reputation and customer service with SHS's expertise, processes and technology is expected to significantly grow the efficiency and viability of the business, while creating an organization that provides Canadians with a trustworthy, reliable and affordable alternative in the home improvements arena,' former president and CEO Calvin McDonald said in a release issued at the time. Sears and Alaris Income Growth Fund are the only two secured creditors. The remaining 17 pages of unsecured creditors range from individuals to Bell Canada to roofing companies and the City of Ottawa. Former Sears CEO Mark Cohen, who is now a professor of marketing at Columbia Business School, said that when he left the company in 2004, it was profitable across all divisions, including home services.

'The home services business is a very complicated and challenging business. It prospered at Sears in no small measure because of the leverage from reputation and a large parent company,' said Cohen. By Becky Schlikerman, Sandra, Guy, and Fran Spielman Chicago Sun-Times December 18, 2013 On the heels of closing dozens of schools, Chicago Public Schools is moving its headquarters to smaller offices, in the same building that currently houses Sears' flailing flagship store off State Street, raising questions over its future, the Chicago Sun-Times has learned. CPS will move next year from 125 S. Clark, where it has been since 1998, to the first three floors at 1 N. Dearborn, CPS officials said. Sears Holdings declined repeatedly to comment on whether it is moving from 2 N.

State -- which is in the same building -- or more broadly, about its future in downtown Chicago. Spokesman Howard Riefs said in a statement: 'The store will continue to serve our members and customers as normal, including throughout the holiday season.' The spokesman would not expand beyond that statement. Meanwhile, CPS is looking toward the move, which comes on the heels of the district's closing of a record number of schools. 'As everybody knows, the basis for that was underutilization, so we turned that mirror on ourselves and discovered that our headquarters is over 50 percent underutilized,' said Tom Tyrrell, CPS' chief operating officer.

The Chicago Board of Education is anticipated to take up the move on Wednesday. Officials say moving will save tens of millions of dollars over time. CPS officials have been looking at downsizing the central office since spring. The central office staff, which now has about 1,200 people, has shrunk over the years.

Jesse Ruiz, the school board vice president and a lawyer, said there's just too much unnecessary space in the current office building. 'The office I'm assigned at CPS headquarters is larger than my law firm office,' he said. The 19-story building CPS now owns and occupies will go on the market in the coming weeks. Tyrrell declined to say what it might be worth.

When CPS bought the building in 1998 from ComEd, it paid $8.3 million, a CPS spokesman said. CPS plans to be in the new space by November. Renting the new spot will cost $34.6 million over that period of time, but CPS declined to specify its rent. Staying in the current building would cost $94.9 million over 15 years, he said. Those costs include building operations and maintenance.

'If we're going to be responsible stewards of the public trust, we have to make sure we're making decent business decisions when it comes time to make a business decision,' he said. 'It's just silly to sit here 15 years and shell out $95 million bucks when you don't have to.' The move means CPS will be 'putting $60 million back in classrooms over 15 years,' Tyrrell said. Tyrrell, the retired marine colonel who helped manage the school closings, said the district considered about 140 other buildings to move its headquarters, including 52 empty school buildings. That includes the former Wentworth Elementary School building, 6950 S.

The building was emptied when Altgeld Elementary School was closed and Wentworth was moved into its building. CPS determined that to move and stay in that building would cost $79.4 million over 15 years, including the 'huge' cost to retrofit the vintage building. CPS also looked at options for staying in its current building or converting part of the building to condos, but the savings just weren't there, Tyrrell said. Location also was a consideration. While CPS didn't necessarily need to be headquartered in the Loop, it wanted to be centrally located for those who need to travel to the schools or travel to the CPS central office. That includes people who attend the monthly CPS board meetings. The new Board of Education chambers will be able to fit 250 people -- more than twice as many as in the current building, Tyrrell said.

Sears has been at its State Street location since 2001. At the time, it was lured back to a revived State Street after an 18-year absence. Sears, based in Hoffman Estates, has been cutting costs and inventory and shedding assets -- moves designed to help it return to profitability. In March 2006, Sears opened an e-commerce development center on the fourth floor of the property at 2 N. State, employing software developers, project managers and technical architects.

Marty Stern, board chairman of the Chicago Loop Alliance, said he's not aware of any imminent plan by Sears to close its State Street store. But if the store does ultimately close, Stern said it would only be a 'temporary hiccup' for State Street that could be easily overcome by retaining ground-floor retail. Contributing: Brian Slodysko. By Ari Altstedter, Bloomberg News December 18, 2013 TORONTO -- Soheil Khojasteh walks through the Sears Canada department store in Toronto's Eaton Centre without a second glance at men's shoes on sale for 40 percent off, gold earrings marked down 65 percent and signs declaring 'Everything Must Go!' 'I don't shop at Sears for clothes to be honest, I just shop at Scotch & Soda and Club Monaco,' the 24-year-old dental student said Monday, referring to the boutique stores at the downtown mall in Canada's biggest city. 'I don't think Sears has what I look for in terms of my style.'

With urban shoppers like Khojasteh going elsewhere, Sears Canada, the country's largest department store chain, is closing the Eaton Centre store along with four other locations as it shifts focus to middle-class families in smaller rural and suburban markets. The closures may not be the last, Chief Executive Officer Douglas Campbell said. 'There could be other opportunities where there is real estate that is greater than the trading value, it all depends what the offer is on those particular properties,' Campbell said in an interview at the Eaton Centre store on Friday. There is 'opportunity for more store closures.' Campbell is trying to stop a streak of 20 straight quarters of declining year-over-year revenue by catering to smaller markets where the brand has a larger presence, while squeezing value out of its real estate assets for shareholders, including Sears Holdings and its CEO Edward Lampert. After making C$400 million ($378 million) on its latest lease sales -- which it used to fund a special C$5 dividend for shareholders -- Sears will have 111 stores across Canada. The company considers 17 of those to be in urban markets and the rest in mid-sized markets, Vincent Power, a spokesman for Sears Canada, said in an email.

Sears also has a network of 241 smaller Hometown franchises in rural or small markets. Lampert has been spinning off and selling assets at Sears Holdings, most recently the profitable Lands' End clothing brand, to fund a turnaround of the parent company. In addition to Sears Holdings' 51 percent stake in Sears Canada, Lampert directly owns 27.6 percent of the Canadian unit, through his own investment and hedge fund ESL Investments, according to data compiled by Bloomberg. Retailers like Sears have found themselves under pressure in Canada amid an influx of new competition from the U.S., with Target and Wal-Mart expanding into the lower price end of the market and luxury retailers like Nordstrom and Saks Fifth Avenue preparing to enter the luxury segment. 'We are strongest and our heritage is in rural and suburban markets and that is the core and model which we need to grow from,' said Campbell, named CEO on Sept.

24 after former CEO Calvin McDonald left to join cosmetics company Sephora, a unit of LVMH Moet Hennessy Louis Vuitton. Sears Canada is the worst-performing department store stock this month among 15 global peers -- with U.S. Parent Sears Holdings second worst -- after dropping 28 percent since paying out the special dividend Dec. 6, according to data compiled by Bloomberg.

Even with that drop, the stock is up 33 percent this year, ahead of the 6 percent gain in the Standard & Poor's/TSX Composite Index. The stock rose 1.3 percent to C$13.38 Monday after Sears Canada announced Dec. 13 that SHS Services Management, which provides home services like roof and window installations under the Sears Homes Services banner, entered receivership and said it would no longer provide Sears with its services. Sears is working with the receiver, PricewaterhouseCoopers on a viable option for the future of the home service business, the company said. As SHS and Sears were separate entities there will be no impact on any business within Sears Canada, Power said in an email Monday. 'They're going to do what's best for Sears Holdings,' said Don Lato, who manages about C$50 million, including shares of Sears Holdings, as president of Padlock Investment Management in Toronto.

'He'll sell the leases that he can for the most profit and if there's something left as an ongoing entity -- and there may not be, it may be the value is truly in the leases -- you may see potentially a wind up of Sears two or three years from now.' For Campbell, the focus is on containing costs and serving middle-class families. Sears's business has shrunk in recent years but its costs haven't declined at the same pace, Campbell said. The key to stabilizing the business now is bringing costs in line with revenue, he said. 'We have to get the operating costs right for our business,' he said. 'We used to be a C$6 billion business, now we're closer to a C$4 billion business and those adjustments haven't been made in our costs.'

As an example, he points to the almost 800 job cuts in November in the company's auto service business. As for the C$315 million Sears will receive after selling its interest in eight Quebec properties, Campbell said he will determine how to use the money when the deal closes, though the stores there would stay open. Sears Canada's third quarter revenue declined 6.4 percent from a year earlier to C$982.3 million and the net loss rose to 48 cents per share from 22 cents a year earlier due in part to restructuring costs, according to a statement from the company. Sales in stores open at least a year increased 1.2 percent, the first quarterly same store sales increase since 2008, according to the statement. 'Usually a company will take its proceeds when they're trying to reinvent themselves, and use that in the process of reinventing themselves,' said Alex Arifuzzaman, a partner of Interstratics Consultants, a Toronto-based retail consulting firm. 'In this case from what I'm seeing they're giving it back to the shareholders, which is more of a liquidation process. It's a slow motion liquidation.'

Christine Hong, a 26-year-old student, was also making a beeline through Sears on Monday, clutching a Zara bag, on her way to other stops at the Eaton Centre. Along with Inditex's Zara she also frequents Ralph Lauren's Club Monaco outlet and Urban Outfitters stores, but not Sears. When asked what she hopes will take Sears' place when it closes, Hong answers immediately. By Vipal Monga Dow Jones Newswire December 16, 2013 Investors are eagerly lending to risky retail borrowers like RadioShack, Sears Holdings and J.C. Penney, buying the chains time to try to turn around their businesses but delaying the overbuilt industry's day of reckoning. Struggling retailers may have never had it so good. Too good, some would argue.

Investors, desperate for higher returns, are eagerly lending to risky borrowers like RadioShack Corp., Sears Holdings Corp. Penney Co., buying the chains time to try to turn around their businesses in the face of weak sales and fierce competition. But what’s encouraging for those companies is a problem for their retailing competitors that also cater to the nation’s financially stretched middle class.

A building boom in the years before the credit crisis has left the U.S. With a surplus of stores. While chains like Gap Inc. Are closing locations and scaling back others, some analysts think it will take a few bankruptcies and liquidations to bring the market back into balance. RadioShack, Sears and J.C. Penney all say their liquidity is adequate, and their ability to continue as going concerns hasn’t been cast into doubt. But easy credit is delaying the industry’s day of reckoning, putting pressure on middle-market chains that already are grappling with slow sales growth and consumers who can be won over only with deep discounts.

'What you’ve got here is a market that still has more players than are necessary,' said Antony Karabus, CEO of Hilco Retail Consulting. 'They’ve bought themselves time, but they’re still all eating from the same pie.' It’s telling that the more-prominent retailers to have raised so-called rescue financing recently are ones that cater to middle-class shoppers. While discount retailers such as Dollar General Corp.

And luxury-oriented chains such as Neiman Marcus Group Inc. Are gaining market share, Wal-Mart Stores Inc., J.C. Penney, and Sears have been losing ground.

The math is simple, but the financial trade-offs can be difficult. The median household income in the U.S.

Fell 8.3% between 2007 and 2012, according to the Census Bureau. To make ends meet, more middle-class Americans are bargain- hunting for essentials in the aisles of Dollar General, instead of shopping for flat-screen TVs at Sears. The market share of Sears, which also owns Kmart, has shrunk to 2% this year from 2.9% in 2005. Downstream, Dollar General’s share has almost doubled to 1.1% over the same period, according to research firm Euromonitor International. Meanwhile, incomes grew by 31.4% for the top 1% of Americans from 2009 to 2012, according to a recent study by the University of California at Berkeley.

That helps explain why luxury retailer Nordstrom Inc. Has increased its market share to 0.7% from 0.5% in 2005.

'The middle-tier types of firms are suffering,' said Jack Kleinhenz, chief economist for the National Retail Federation. 'There is a lot of competition in retail, and they have very thin margins. There’s going to be a sorting among retailers.'

Yet Sears Chief Executive Edward Lampert has been able to raise money for the store chain even as its sales and profits shrink. In October, Sears secured a $1 billion loan to repay money it had borrowed under another asset-backed credit line, despite reporting just 41 days earlier that it had a loss of $194 million and a revenue decline of 6.3% in its fiscal second quarter. The loan will mature in 2018, two years after the credit line, giving Sears more time to restructure by taking steps like spinning off its Lands’ End apparel business. Retailers can borrow money by pledging collateral such as inventories and buildings. The loans can be expensive, however, and that puts pressure on businesses by increasing their interest burdens.

Last week, RadioShack signed a $835 million financing deal. The arrangement included a revolving credit line and a $50 million loan from General Electric Co.’s GE Capital unit, as well as another $250 million loan from Salus Capital Partners LLC. The deal, which replaces a smaller financing package, will give RadioShack an extra $200 million, but its annual interest payments will jump about $9 million to just over $60 million, according to a person close to the company. The money won’t just help fund the chain’s turnaround plan; it also sends an important signal to vendors that RadioShack is still viable, said one person involved in the financing. 'It’s important to show liquidity to landlords and to get products at reasonable rates,' the person said.

Access to funding has kept default rates low across the corporate landscape. Default rate for junk-rated borrowers--such as RadioShack, Sears and J.C. Penney--was just 2.5% in October, down from 3.6% a year earlier, according to Moody’s Investors Service. Penney has been working to right itself after a disastrous year under former Apple Inc. Executive Ron Johnson, who oversaw a $1 billion loss and 25% sales decline during his first full year as the retailer’s chief executive.

In April Penney replaced Mr. Johnson with CEO Myron 'Mike' Ullman, who moved quickly to borrow $1.75 billion and raise another $785 million in a stock sale in late September. The boost in liquidity has allowedPenney to offset higher surcharges imposed by some suppliers and buy time for Mr. Ullman’s turnaround plan. Penney declined to comment, but its efforts appear to be bearing some fruit. For November the retailer reported that sales at stores open for at least a year rose 10% from November 2012, the second month in a row that sales have improved. By Justin Lahart Wall Street Journal December 13, 2013 Retail-Sales Numbers Show Department Stores Continue to Struggle, but J.C.

Penney Is Finally Finding a Way to Tread Water If J.C. Penney manages to turn itself around, investors may have one man: Sears Holdings chief Eddie Lampert. The good news, such as it is, from Penney lately is that it has finally stanched the declines that have plagued it.

The company last week estimated same-store sales rose 10% in November from a year ago, setting it up for its first quarter of same-store sales growth in more than two years. But it isn't yet clear how many of the customers lost during Apple executive Ron Johnson's failed makeover the company will regain. And the existential problem that paved the way for Mr. Johnson's reign remains: Penney belongs to a retailing category--department stores--in steady decline, losing share to general merchandisers such as Wal-Mart Stores and Target. Thursday's November retail-sales report from the Commerce Department showed department-store sales now account for just 6.1% of retail sales away from gasoline stations, car dealers and building-materials stores.

That compares with 15.6% some 20 years earlier. Minna No Nihongo Chukyu Ebook Login. Penney chief Myron Ullman has taken steps to boost sales, such as bringing back in-house brands and reinstating coupons.

The company has also heavily marked down upscale inventory acquired for Mr. Johnson's plan to clear it out quickly and make its mix of goods more in line with what its customers want. To the extent many of the customers Penney lost may have been opting for Sears, getting them back may not be as hard as it might otherwise have been. Indeed, a bright spot for Sears recently had been apparel sales--a sign it had been taking share from Penney. But when it reported results last month, apparel sales at its domestic Sears stores fell. Penney may not mind a smaller pie if it gets a bigger slice. By Laura Stevens Wall Street Journal December 10, 2013 ATLANTA -- Cameron Holloway, a sales associate at Sears in the Cumberland Mall here, is hard at work helping a customer--a virtual shopper 300 miles away in Semmes, Ala.

The Sears website just sent a message to Mr. Holloway's iPhone telling him the customer wants a $145 18-inch Craftsman chain saw, so he retrieves one from the store floor, labels it and loads it onto a pallet next to cameras, tools and other holiday gifts. A United Parcel Service Inc. Truck will arrive to ship it west, and Mr. Holloway will have successfully kept Sears from losing another holiday shopper to Amazon.com, Inc.

'If you want to go head-to-head with Amazon, you go out and build a bunch of distribution centers,' said Jeff Starecheski, vice president of logistic services with Sears Holding Corp., referring to the dramatic steps some competitors consider to stave off the e-commerce rival. But Sears and its sister retail chain Kmart blanket the country with about 2,000 stores.

'We're already close to the customers,' he says. Sears just needed a delivery. The success of the holiday shopping season--the difference between winners and losers--usually hinges on factors like the economy, fashion, color, price, or a blockbuster new items like tablet computers or videogame consoles. Increasingly, though, another factor is coming into play: Shipping. Package delivery is becoming a competitive weapon in the holiday retail season. Retailers ranging from Macy's Inc.to Wal-Mart Stores Inc.

Embraced shipping to compete against Amazon. They are shuttling merchandise on demand from store to store, warehouse to store, store to customer--often both quickly and free. Entering the fray over shipping is viewed as a necessity when online sales are growing at nearly four times the rate of overall retail sales and where people who shop online, on average, plan to spend 20% more than people who shop only in physical stores, according to research firm eMarketer. About a third of all retailers already use brick-and-mortar stores as fulfillment centers for online orders; another 26% plan to do this soon. UPS and FedEx Corp., which were critical to helping launch the e-commerce boom, are now eager to help traditional retailers deal with it. They have engineered new strategies for jockeying inventory across the country to avoid overstocks and markdowns and to keep customers from defecting to Amazon, a big problem last year.

The strategy is also important this holiday season as clothing retailers are threatened with heavy inventories. UPS says it is working with about 40 retailers on implementing these strategies--about double the number a year ago. FedEx said these partnerships helped boost revenue in its ground delivery business 11% in its fiscal first quarter. Both forecast record holiday-season deliveries: UPS with 34 million packages on Dec. 16 and FedEx with 22 million packages on Cyber Monday. In the case of Sears, UPS provided software that shows shipment statuses of all orders across the entire system.

It also sends tracking numbers. When a customer in Brooklyn ordered a girl's size-7 pink-and-purple coat--which was out of stock up north--software searched Sears's inventory and directed the order to Atlanta.

'If a consumer comes to your website and the product's not available, you typically lose the sale,' said Alan Gershenhorn, chief sales, marketing and strategy officer at UPS. These methods allow retailers to 'pull and display the inventory from both your brick-and-mortar stores and your online inventory, so you're going to run into that problem less and less.' Shipping does matter to retailers' bottom lines. Half of online shoppers would consider purchasing from a new online retailer if it offered the lowest-cost or free shipping, and customers often abandon sites without free shipping, according to Forrester Research Inc. Sears piloted its ship-from-store program in early 2012, before rolling it out to 27 Kmart and Sears stores that August.

UPS helped the retailer determine which locations should be shipping centers to cover 80% of all customers by next-day ground. At peak season in December, dedicated in-store staff will have the capacity across the 27-store network to fill 20,000 orders a day, with the ability to fill 30% more order. Online sales account for less than 2% of Sears' $40 billion in annual revenue, according to analyst estimates and company filings.

Analysts say the real problem for Sears is its stores, many of which are run down and dilapidated after the chain spent about half of what competitors J.C. And Macy's invested in store upkeep. Sears lost $534 million in the quarter that ended Nov. 2, compared with a loss of $498 million a year earlier. Revenue declined 7% to $8.3 billion.

Sears declined to comment on online sales. The company has invested hundreds of millions of dollars in improving stores and technology, a spokesman said. Employed FedEx when it decided to fill online orders from its 43 stores a year ago. FedEx is now joining with Saks on an experiment in same-day delivery in Florida. Over the past year, orders processed in store have jumped to 15%, from about 8%.

'We've always had FedEx software in our shipping departments, but we've worked together collaboratively on how to handle peak workloads,' including adding pickup times, said Ed Stagman, Saks' senior vice president of store operations. Some logistics experts doubt the ship-from-store strategy is feasible long term because inventory is often scanned incorrectly by cashiers, meaning it is too difficult to know what's actually available in specific stores. Even retailers say shipping is an added expense that must make economic sense. 'It's all a balancing act,' said Jim Sluzewski, senior vice president with Macy's, which now has 500 stores shipping with UPS after starting in 2011.

This requires being strategic to 'turn inventory faster--and do it while maintaining margins.' If retailers don't get it right, they take a big risk: 89% of customers say they are likely to choose other retailers in the future if an item is delivered late, according to a survey commissioned by consultant Capgemini Group. Back at the Sears in Atlanta, UPS driver Paul Godfrey backs his truck into the loading dock and picks up three pallets of packages, including the chain saw and coat.

He drives them to a nearby logistics center, which sorts a quarter of approximately 200,000 packages processed daily by UPS in Atlanta. Workers unload the chain saw, sending it through a maze of conveyor belts before adding it onto the next truck heading to Alabama.

--Suzanne Kapner contributed to this article. Crain's Chicago Business December 9, 2013 (Bloomberg) -- Even after spinning off Lands' End, Sears Holdings Corp.' S Eddie Lampert remains vulnerable on dual fronts: a struggling retail business in need of a new strategy and a hedge fund whose investors have begun pulling their money.

The Lands' End spinoff, announced Dec. 6, gives Sears investors a piece of a profitable clothing brand no longer hindered by an association with the loss-making Sears.

Yet the move may not raise capital that Lampert, the company's largest shareholder, can plow into the business, which is burning cash amid dwindling traffic to rundown stores. Separately, Lampert issued Sears stock last week to investors redeeming shares in his hedge fund, ESL Partners LP. The moves reduced his stake in the department-store chain to 48 percent from 55 percent. Additional redemptions by ESL Partners holders could reduce his Sears stake further, loosening his grip on a company he's controlled for nine years. 'His investors are running out of patience,' said Erik Gordon, a professor at the University of Michigan's Ross School of Business in Ann Arbor. 'He's running out of time to keep pulling rabbits out of the hat.

He's going to have to start producing sales in the stores.' Sears declined to make Lampert available for comment. A mercurial and remote leader who has presided over a revolving cast of executives, Lampert has confounded retail analysts by introducing and abandoning one strategy after another.

His latest idea is to turn Sears into a membership chain centered around its rewards-card program. How this is supposed to return Sears to growth remains unclear. DIVIDING COMPANY Adding to his challenges, Lampert has pitted executives against one another by dividing the company into separate operating units, according to dozens of former executives. The shares fell 1.1 percent to $47.54 at 9:41 a.m. They had gained 16 percent through Dec.

6, compared with a 41 percent gain for the 31-member Standard & Poor's 500 Retailing Index. Sears Holdings, which includes the Kmart chain, has posted six years of declining revenue in large part because Lampert has underinvested in the stores. In 2012, the company spent about $1.51 a square foot on its Sears stores and $1.04 on its Kmart stores, compared with $5.56 at Home Depot Inc., and $6.25 at Macy's Inc., according to Matt McGinley, a managing director at International Strategy & Investment Group in New York. There is less and less money to update them -- even if Lampert were inclined to. Sears's operations have consumed cash for six of the past seven quarters.

The retailer said last month that it had $607 million in cash as of Nov. 2 and that it expects to generate $2 billion of liquidity in the current fiscal year, up from an earlier forecast of $500 million. SEARS TRANSFORMATION 'It's not fair to say we haven't invested in the future and transformation of the company,' Howard Riefs, a Sears spokesman said in an e-mail. 'Store investment may be necessary but it's not sufficient in helping to transform a traditional retailer to a retailer that's more competitive.' Sears is shifting into a business that serves customers 'in the manner most convenient for them: whether in store, in home or through digital devices,' he said. To shore up the balance sheet, Lampert has been selling off assets.

Last year, he split off Sears's smaller-format Hometown and Outlet stores to raise about $446.5 million. He also spun off a portion of Sears's stake in Sears Canada as well as an investment in the Orchard Supply hardware stores. Selling Lands' End may not have been an option for Lampert because he wouldn't get anywhere near the $1.9 billion Sears paid for the brand in 2002, according to Paul Swinand, an analyst at Morningstar Inc.

Lands' End would probably fetch no more than $1 billion, he said. SPINOFF PAYOUT The retailer still could structure the spinoff to include a payout to the parent company or to investors, said Mary Ross Gilbert, an analyst at Imperial Capital LLC in Los Angeles. Sears could issue $100 million to $300 million in debt to fund such a payout, she said. 'While this is favorable to the shareholders, it's detrimental to creditors,' Gilbert said.

'As they sell off or spin off these profitable businesses, these cash-generating businesses, you're left with higher losses at Sears.' Next on the block: the retailer's automotive unit, a chain of more than 700 service centers offering repairs and routine maintenance such as oil changes. Estimates of how much the business is worth range from $600 million to $1 billion. However, because there are no competitors with national scale, finding a strategic buyer may be difficult, McGinley said. RAISING CASH Lampert has been raising cash by selling stores and leases, too. He sold 11 locations to General Growth Properties Inc. For about $270 million in cash proceeds last year.

In October, the company said Sears Canada is selling five store leases to Cadillac Fairview Corp. For C$400 million ($376 million). Sears said it is continuing to evaluate its U.S. Stores, including leased locations that are set to expire. Vadim Perelman, whose Baker Street Capital Management is Sears's ninth-biggest shareholder, remains bullish on Lampert's vision and in September issued a report called 'The Case for Sears Holdings,' which argued that the company's real estate is worth more than $7 billion. 'We think the business will look quite different in three to five years,' Perelman said in an interview. 'We think they're working pretty hard to figure out a way to become profitable, or less unprofitable.'

While Lampert said last week he's still focused on creating long-term value at Sears, he has lost the faith of a group of clients that invested about $3.4 billion in his main fund, ESL Partners, as early as 2007, when the stock was trading at much higher prices. LAMPERT REDEMPTIONS All of the investors were required to commit their money for at least five years, Lampert's standard lockup period, a person familiar with the situation said last week. By the beginning of this year, ESL had received notice from these investors that they wanted to redeem all of their money, the person said.

ESL had the right to meet the redemptions over a one-year period rather than pay out at once. Lampert's firm began returning the money last year and continued to do so this year, using both cash and securities such as stock in AutoNation Inc., AutoZone Inc., and Sears, according to the person, who requested anonymity because the information is confidential. In June, ESL Partners reported in a regulatory filing that it distributed $393 million of AutoNation shares to clients who had elected to redeem all or a portion of their investment in the fund. FIVE-YEAR LOCKUP Still, even if other Lampert investors have lost confidence in Sears, they may not flee the fund because they are bound by the five-year lockup. Besides, Lampert's U.S.-traded stock holdings, which include shares in AutoZone, AutoNation and Gap Inc., have gained 25 percent this year. 'A lot of things are coming together at once,' McGinley said.

'His fund is highly concentrated in Sears. As the CEO of the company, I'm sure his primary focus is on making sure that this thing is a viable concern so that his limited partners in his position don't get wiped out.' By Kim Peterson CBS Money Watch December 9, 2013 Eddie Lampert isn't exactly the toast of Wall Street anymore. Investors are starting to lose faith in the chief executive of Sears (SHLD) and prominent hedge fund manager. They're fleeing his fund in droves, and as a result he's lost his majority stake in the struggling retailer. For a while, Lampert was one of the best in the business. His fund, ESL Investments, boasted annualized returns of more than 20 percent for 20 years, The Wall Street Journal reports.

But then the recession hit, and the fund suffered a 33 percent loss in 2008, rebounded with gains of 55 percent and 16 percent in 2009 and 2010, and sagged back to a 12 percent loss in 2011. Although such volatile returns have been common on Wall Street in an economic recovery characterized by fits and spurts, those losses were enough to make some of Lampert's investors want to bail.

Now, a group of clients that came over through Goldman Sachs (GS) have asked Lampert to return the roughly $3.5 million they invested with him in 2007, The Journal reports. But instead of giving those investors cash back, Lampert is paying them partly with Sears stock. He's returned some 7.4 million shares to them, in fact. As a result, ESL now only owns 48.4 percent of Sears' shares, down from 55 percent from as early as October, Bloomberg reports. So were investors happy to get paid in Sears stock?

The answer can be seen in the company's plummeting share price last week. The stock started a week ago in the $64 range -- the day before Lampert disclosed the fund redemptions -- and closed Friday at $48. And lurking behind that 25 percent drop is a harsh reality: Many of the investors who get paid in Sears shares will turn around and sell. And why shouldn't they? Sears is set to mark three straight years of losses.

The retail environment is 'a vicious minefield,' TheStreet's Jim Cramer wrote last week. 'I don't know anyone who has been able to navigate it.

Perhaps the best thing to do is to just stay away from the darned thing until we get some clarity.' And that's exactly what many investors will do with Sears, leaving Lampert on the outs. To be sure, he still has some $2.5 billion in outside investor money left to play with, and his legendary investing prowess may help him work wonders with that money in a booming market. But for now, Lampert's empire looks like it's just starting to crack. November sales at stores open for longer than a year appear to be down by a percentage in the mid-to-high single digits, an analyst at Cleveland Research told Bloomberg, while Sears continues to lose market share in the important home-appliance market.

Can Lampert turn things around? Nothing spooks investors like a mass exit, and it will take an extraordinary amount of work on his part to calm the waters. By Ameet Sachdev Chicago Tribune December 8, 2013 The combination of Sears and Lands' End wasn't quite a fashion nightmare but it isn't a good fit either. That's more apparent now as Sears Holdings Corp. Disclosed plans Friday to separate Lands' End into its own publicly traded company, a little more than a decade after it acquired the preppy apparel retailer to spice up its clothing lines. For the first time since the 2002 acquisition, the public got a look at Lands' End financial performance, and the picture is not as pretty as one of the retailer's catalogs. The company reported $49.8 million in profit on $1.58 billion in revenue in its last fiscal year, down from $134.9 million in profit on $1.65 billion in sales in 2008.

In particular, Lands' End departments within Sears stores are unprofitable. Mary Ross Gilbert, a financial analyst who follows Sears, said the results were weaker than she expected. 'This was supposed to be one of the jewels of Sears' portfolio,' said Gilbert, managing director of Imperial Capital, an investment bank in Los Angeles. 'I would say it's not that shiny of a jewel.' While Lands' End suffered under Sears Holdings' ownership, stock analysts said the company has potential as an independent company. Sears stockholders who will receive shares in Lands' End should take comfort that the retailer known for classically styled clothing still has a lot of loyal customers and a nationally known brand associated with high quality and good customer service. 'I don't think it's perfect, but it's not beat up,' said Paul Swinand, an analyst at Morningstar in Chicago.

'It should have improved prospects on it own.' But Sears Holdings will still loom large over Lands' End's operations after the planned spinoff. Edward Lampert, Sears Holdings' chairman and chief executive officer, is expected to own nearly 50 percent of Lands' End's stock following the separation. He owns a similar stake in Hoffman Estates-based Sears Holdings.

Lampert created his retailing empire by merging Kmart with Sears, Roebuck and Co. But the combination has not worked, as Sears and Kmart have each lost customers because of outdated stores and intense competition.

Sears Holdings lost $3.1 billion in 2011, $930 million in fiscal 2012 and $1 billion in the first nine months of fiscal 2013, which ends in January. Lampert has been selling stores and spinning off assets, such as Orchard Supply hardware stores and Sears Hometown and Outlets stores.

In October, Sears Holdings said it was considering separating its auto center unit and Lands' End. Sears Holdings took the first steps to spin off Lands' End to shareholders by filing a registration statement Friday with the Securities and Exchange Commission.

In the filing, Lands' End said Lampert and his hedge fund, ESL Investments, 'are expected to exert substantial influence' over the company, and their interests may 'diverge' from the interests of other stockholders. Lands' End also pointed out that a portion of its sales are tied to the success of Sears stores, a significant risk considering Sears' deteriorating performance. In paying $1.9 billion for Lands' End, Sears hoped to become the preferred shopping destination for suburban moms. The average annual household income of Lands' End customers was $104,000, and nearly half of its customers were between 36 and 55 years old. Sears' strategy was to create a 'store within a store' business model. In 2005, it opened its first 'Lands' End Shop' at Sears.

As of August, there were 275 Lands' End Shops. These 'shops' accounted for 16 percent of Lands' End revenue in 2012, or $253.7 million. Sears has about 800 stores in the United States. But the retail partnership with Sears is losing money. Lands' End said the bricks-and-mortar business, which includes a handful of outlet stores, had an operating loss of $10.2 million in 2012. The poor performance continued in the first half of 2013.

Revenue at Lands' End bricks-and-mortar business fell 12 percent. What's more disappointing to analysts is that Lands' End online and catalog sales also are declining. In the first half of this year, direct sales fell 1 percent from the same period a year ago. In 2012, direct sales fell 9 percent. 'This is not a growth situation,' Gilbert said. However, Lands' End is one of Sears Holdings' best-performing assets, according to analysts.

Without Lands' End going forward, Sears Holdings' prospects look even bleaker. Before the spinoff, Swinand had estimated Sears Holdings' 2014 earnings before interest, taxes, depreciation and amortization at less than $100 million. Exclude Lands' End -- which generated about $100 million in EBITDA last year -- and Sears Holdings will have to continue to sell assets and shrink working capital, he said. Sears Holdings stock price fell $1.89, or 3.8 percent, to close Friday at $48.09. Sears Holdings said it expects the Lands' End spinoff to be a tax-free distribution to shareholders. The securities filing did not mention how much debt an independent Lands' End will carry and whether it will pay a dividend to Sears Holdings.

Lands' End's headquarters will be in Dodgeville, Wis., where it maintains administrative offices and a large distribution center. Chief Executive Edgar Huber is expected to remain in charge after the spinoff. By Suzanne Kapner Dow Jones Newswire December 6, 2013 Apparel Maker Reveals Surprisingly Poor Financials as It Announces Plans for Spinoff Lands' End has suffered under Sears, and the planned spinoff won't exactly set it free. The companies originally Lheralded the merger as a strategic fit that would help the mail-order retailer grow faster and drive traffic to the venerable department store. But the ambitious goals bogged down in Sears's deteriorating stores.

After a string of record profits that ended in 2008, Lands' End's results have deteriorated. The 50-year-old maker of preppy chinos and fleece jackets brought in $50 million in profit on $1.6 billion in revenue in the company's last fiscal year, down from $135 million in profit on $1.7 billion in revenue in 2008. Gary Balter, an analyst with Credit Suisse, on Friday called Lands' End's numbers 'surprisingly weak.' Sears Holdings Corp SHLD in Your Value Your Change Short position shares fell 3.8% Friday to $48.10, even as the broader market rallied. Sears took steps Friday to separate its Lands' End unit by filing a registration statement with the Securitie.s and Exchange Commission.

The move will end a rocky marriage between the two companies that began when Sears bought Lands' End for $1.86 billion. Lands' End gets 18% of its total revenue from retail stores, which are mostly shops inside Sears locations. Clayton Hauck for The Wall Street Journal Yet even after the spinoff, the chains will remain linked. Lands' End drew 18% of its revenue from its brick-and-mortar retail business, and that depends on its ability t.